Abstract
Accumulating studies have shown that the dysregulation of microRNAs is related to the carcinogenesis and development of gastric cancer (GC), and the role of miR-635 in GC remains largely unknown. miR-635 and Kinesin Family Member C1 (KIFC1) mRNA expression in GC tissues and paracancerous tissues and cells were detected by quantitative real-time PCR. KIFC1 protein expression in GC tissues and paracancerous normal tissues and cells was detected by immunohistochemistry and western blot. Cell proliferation was monitored by Cell Counting Kit-8 assay and 5-bromo-2′-deoxyuridine assay. Transwell assay was employed to detect the migration and invasion of GC cells. The dual-luciferase reporter gene assay was adopted to detect the targeting relationship between miR-635 and KIFC1. Compared with paracancerous tissues, miR-635 expression was remarkably decreased in GC tissues; conversely, KIFC1 expression was significantly increased. Compared with human normal gastric epithelial cell GSE-1, miR-635 expression was markedly decreased in GC cell lines. Meanwhile, KIFC1 expression was significantly increased, and the Kaplan-Meier Plotter database showed that its high expression was remarkably associated with poor prognosis. Additionally, miR-635 can negatively regulate KIFC1. miR-635 can target KIFC1 to inhibit proliferation, migration and invasion of GC cells. Collectively, miR-635 is lowly expressed in GC, and it inhibits proliferation, migration and invasion of GC cells via regulating KIFC1.
Significance of this study
What is already known about this subject?
Gastric cancer (GC) is one of the most common cancers in the world and the third leading cause of cancer-related death.
The role of microRNAs in the development of tumors has been extensively studied.
As a tumor suppressor, miR-635 participates in the regulation of human malignant tumor progression.
What are the new findings?
miR-635 was lowly expressed in GC tissues and cell lines. miR-635 inhibited GC cell proliferation, migration and invasion. Kinesin Family Member C1 (KIFC1) has been proven to be the target gene of miR-635 and is negatively regulated by miR-635.
How might these results change the focus of research or clinical practice?
miR-635 and KIFC1 are potential indicators for assessing the clinical progress of GC and evaluating the prognosis of patients.
Introduction
Gastric cancer (GC) is one of the most common cancers in the world and the third leading cause of cancer-related death.1 In China, the first diagnosis of most patients with GC is in the advanced stage. Despite the continuous progress of surgery, radiotherapy and chemotherapy and targeted molecular therapy for GC, treatment of GC is still unsatisfactory, with a median overall survival of only 10–12 months.2 Therefore, it is of great significance to investigate new therapeutic targets and methods to treat patients with GC.
MicroRNAs (miRNAs) are small non-coding RNAs that bind to the sequence of the 3′-untranslated regions (3′-UTR) of their downstream mRNA and mediate the degradation of the corresponding mRNA or inhibit its translation.3 In recent years, the role of miRNAs in the development of tumors has been extensively studied. For instance, miR-769–5p is up-regulated in hepatocellular carcinoma and promotes proliferation, migration and invasion of cancer cells,4 while miR-451a inhibits the growth of papillary thyroid carcinoma, epithelial–mesenchymal transformation (EMT) and facilitates apoptosis.3 The role of miRNA in the pathogenesis of GC has also been reported. For instance, miR-592 is up-regulated in GC and facilitates cell proliferation and metastasis; however, miR-331 inhibits GC development.5 In non-small-cell lung cancer, miR-635 inhibits cancer progression via regulating the Janus kinase/signal transduction and activator of transcription (JAK-STAT) axis.6 Nevertheless, the role and mechanism of miR-635 in GC remain largely undefined.
Increasing studies have shown that miRNAs can bind to downstream target genes to affect cancer progression. For example, miR-143 has been shown to repress the migration and invasion of cancer cells in prostate cancer by down-regulating TFF3.7 The Kinesin Family Member C1 (KIFC1), as a potential downstream target of miR-635, has a key regulatory role in a variety of tumors. For instance, it has been validated to enhance bladder cancer cell proliferation and induce EMT8; it also promotes the proliferation and metastasis of liver cancer cells and inhibits their apoptosis, and its overexpression is associated with poor prognosis of patients.9 However, the role of KIFC1 in GC is much less explored.
This study detected miR-635 expression and KIFC1 expression in GC tissues and cells, and explored their functions in GC progression. Additionally, we investigated the regulatory mechanism between them.
Materials and methods
Tissue sample collection
The specimens (cancer tissues and adjacent normal tissues) were obtained from 47 patients who underwent surgical resection of GC in our hospital from April 2017 to July 2018. All patients involved gave informed consent to the study and signed a written consent form before sample collection.
Cell culture and transfection
Human normal gastric epithelial cells (GSE-1 cells) and human GC cell lines (HGC-27, BGC-823, MGC-803, SGC-7901, and AGS cells) were purchased from China Center for Type Culture Collection (Wuhan, China). miR-635 mimics, miR-635 inhibitors and control miRNAs were purchased from Ribobio (Guangzhou, China). Overexpressing KIFC1 plasmids (pcDNA3.1-KIFC1), shRNA targeting KIFC1 (sh-KIFC1), control plasmids (pcDNA-NC) and negative control shRNA (sh-NC) were purchased from Genechem (Shanghai, China). All cells were cultured in RPMI 1640 medium (Thermo Fisher Scientific, Shanghai, China) containing 10% fetal bovine serum (FBS; Invitrogen, Grand Island, New York, USA) and 1% penicillin/streptomycin (Hyclone, Logan, Utah, USA) and were routinely cultured in an incubator at 37°C in 5% CO2. The cells in the logarithmic growth phase were trypsinized and subcultured using 0.25% trypsin (Thermo Fisher HyClone, Utah, USA). BGC-823 cells and MGC-803 cells were transfected using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Waltham, Massachusetts, USA) in compliance with the supplier's instructions, and quantitative real-time PCR (qRT-PCR) was employed to measure the transfection efficiency.
Quantitative real-time PCR
Total RNA of tissues or cells was extracted using TRLzol kit (Invitrogen, Carlsbad, California, USA) for quantitative analysis, and then complementary DNA was synthesized by reverse transcription with PrimeScript RT Reagent Kit (Invitrogen, Shanghai, China). Real-time PCR was performed on the ABI 7500 Real-Time PCR System (Applied Biosystems, San Francisco, California, USA) using the SYBR premix EX TAQ II (TaKaRa, Dalian, China) according to the manufacturer' s instructions. U6 and β-actin were regarded as the internal references, and the relative expression of miR-635 and KIFC1 mRNA were calculated using the 2−ΔΔCT method. The primers were obtained from Genecopoeia (Guangzhou, China), and the detailed sequences are shown as follows: miR-635, F: TATAGCATATGCAGGGTG, R: CGCATTCGGAGTGCGAGTT; KIFC1, F: TGAGCAACAAGGAGTCCCAC, R: TCACTTCCTGTTGGCCTGAG; U6, F: CTCGCTTCGGCAGCACA; R: AACGCTTCACGAATTTGCGT; β-actin, F: GCCGGGACCTGACTGACTAC, R: TTCTCCTTAATGTCACGCACGAT.
Cell Counting Kit-8 (CCK-8) assay
BGC-823 and MGC-803 cells (at a density of 2×10 3/mL) in the logarithmic growth phase were seeded in 96-well plates. At different time points, 10 µL CCK-8 solution (Dojindo, Kumamoto, Japan) was added to each well. The plate was incubated in an incubator for 4 hours, and the absorbance of the cells at 450 nm was measured with a microplate reader (Bio-Rad, Hercules, California, USA). The changes of cell numbers of BGC-823 and MGC-803 cells at 24, 48 and 72 hours were determined using the method mentioned earlier, and then the proliferation curve was plotted.
5-Bromo-2′-deoxyuridine (BrdU) experiment
BGC-823 and MGC-803 cells in the logarithmic growth phase were collected and resuspended into single-cell suspensions and were inoculated on slides placed in a 24-well plate at a density of 1×105 cells/well. After being cultured for 12 hours, 10 μmol/L BrdU solution was added and incubated at 37°C for 4 hours. Then the medium was discarded and the slides were rinsed with phosphate buffer saline (PBS). After that, cells were fixed with 70% ethanol for 10 min at 4°C. Then the slides were rinsed with PBS again and 2 mol/L HCl was added to denature the DNA. After HCl was discarded and the slides were rinsed with PBS again, 1% bovine serum albumin was added at room temperature to incubate the cells for 1 hour. Next, 100 µL of BrdU monoclonal antibody (Abcam, ab1893, 1:300) was added to incubate the cells for 12 hours at 4°C. Then the Cy3-labeled goat anti-mouse fluorescent secondary antibody was added to incubate the cells for 2 hours at room temperature. After the nuclei were stained with 4',6-diamidino-2-phenylindole, the cells were observed under a fluorescence microscope, and the proliferation rates of GC cells were recorded and analyzed.
Transwell migration and invasion assay
Transwell experiment was carried using Transwell chamber (8 µm pore size; Millipore, Billerica, Massachusetts, USA). The cells in the logarithmic growth phase were harvested and the cell density was adjusted. In the migration assay, 104 cells suspended in serum-free medium were added to the upper compartment of the Transwell chamber, and then 600 µL medium containing 15% FBS was added to the lower compartment, and the cells were routinely cultured for 24 hours. The next day, the chamber was removed, and the cells in the upper compartment were wiped with a cotton swab, and the migrated cells were washed three times with PBS, fixed for 30 min with methanol, stained with 0.1% crystal violet for 20 min, and washed three times with PBS. After that, the cells were observed under a microscope. In the invasion assay, a proper amount of Matrigel (1:10; BD Biosciences, Franklin Lakes, New Jersey, USA) was used to cover the surface of the membrane, and the follow-up steps were the same as previously mentioned.
Immunohistochemistry (IHC)
After the tissue was embedded in paraffin, the tissue was sliced continuously with a thickness of 5 µM. Subsequently, the slides were dewaxed with xylene, dehydrated and rehydrated, and then the primary antibody (anti-1; Abcam, ab235994, 1:100) was used to incubate the slices overnight at 4℃, and the then slices were incubated with the secondary antibody at room temperature for 30 min. Subsequently, the slices were rinsed thoroughly with PBS solution. The reaction was then terminated using DAB (Boster Biological Technology Co, Wuhan, China) after color development. The IHC results were observed and scored by two independent pathologists.
Luciferase reporter assay
Luciferase reporter assay experiments were conducted using a dual-luciferase reporter assay system (Promega, Madison, Wisconsin, USA). Wild-type (WT) 3′-UTR of KIFC1 and mutated 3′-UTR of KIFC1 sequences were constructed and integrated into pGL3 vector (Promega). HEK-293T cells were cotransfected by luciferase reporter plasmids (including WT or mutant plasmids) and miR-635 mimics or control miRNAs. After 48 hours of transfection, luciferase activity was determined in compliance with the manufacturer's protocol.
Western blot
The cells in the logarithmic growth phase were used to extract total protein using RIPA lysis (Sigma-Aldrich, St. Louis, Missouri, USA), and the protein was quantified by bicinchoninic acid (BCA) method (Beyotime Institute of Biotechnology, Haimen, China). The protein was separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (Millipore), then transferred to polyvinylidene difluoride membrane (Millipore) and blocked for 2 hours, and primary antibodies anti-KIFC1 (Abcam, ab172620, 1:500) and anti-β-actin (Abcam, ab179467, 1:2000) were added and incubated at 4°C overnight. The next day, the membrane was washed with tris buffered saline tween and then incubated with horseradish peroxidase-labeled secondary antibody (Abcam, ab216773, 1:2000) for 2 hours at room temperature. Ultimately, the bands were visualized with enhanced chemiluminescence (Millipore, Bedford, Massachusetts, USA).
Statistical analysis
In this work, all data were analyzed using SPSS V.17.0 statistical software and GraphPad Prism V.6 (GraphPad Software, La Jolla, California, USA). The measurement data were expressed as mean±SD, which was consistent with the normal distribution of measurement data. The two groups were compared using independent sample t-test, and the difference was statistically significant at p<0.05.
Results
miR-635 was lowly expressed in GC
To investigate the expression level of miR-635 in GC, qRT-PCR was conducted to detect the expression of miR-635 in cancer tissues and paracancerous tissues of 47 patients with GC. As shown, miR-635 expression in the cancer tissue group was significantly lower than that in the normal tissue group (figure 1A), and miR-635 expression was remarkably associated with increased tumor, node, metastasis (TNM) staging and lymph node metastasis of patients with GC (figure 1B,C). Additionally, the expression levels of miR-635 in normal gastric epithelial cells (GSE-1) and GC cell lines (HGC-27, BGC-823, MGC-803, SGC-7901, and AGS cells) were detected. The results showed that, compared with GSE-1 cells, miR-635 expression in GC cell lines was remarkably down-regulated (figure 1D). The results suggested that miR-635 functioned as a tumor suppressor in GC.
miR-635 suppressed proliferation, migration and invasion of GC cells
The aforementioned results revealed that in GC cell lines, miR-635 expression was the lowest in MGC-803 cells and the highest in BGC-823 cells in GC cells. Therefore, miR-635 mimics were transfected into MGC-803 cells, and miR-635-inhibitors were transfected into BGC-823 cells. Successful overexpression or low expression of miR-635 was confirmed by qRT-PCR (figure 2A). CCK-8 and BrdU experiments implied that miR-635 mimics significantly inhibited the proliferation of MGC-803 cells compared with the miR-NC group, whereas miR-635 inhibitors significantly enhanced GC cell proliferation in comparison with the miR-con group (figure 2B,C). Furthermore, Transwell experiments revealed that miR-635 significantly repressed the migration and invasion of MGC-803 cells, while miR-635-inhibitors significantly enhanced the migration and invasion of BGC-823 cells (figure 2D,E). Based on these data, we concluded that miR-635 suppressed the malignant phenotypes of GC cells.
KIFC1 was remarkably highly expressed in GC and was notably associated with poor prognosis in patients with GC
To explore the expression characteristics of KIFC1 in GC, IHC was performed. Compared with normal paracancerous tissues, KIFC1 was significantly highly expressed in GC tissues (figure 3A). Subsequently, KIFC1 mRNA expression in cancer tissues and paracancerous tissues of 47 patients with GC were detected by qRT-PCR. Compared with the normal tissue group, KIFC1 expression in the cancer tissue group was significantly increased (figure 3B). Following that, KIFC1 expression in gastric epithelial cells (GSE-1) and GC cell lines (HGC-27, BGC-823, MGC-803, SGC-7901, and AGS cells) was detected. The results revealed that compared with GSE-1 cells, KIFC1 expression in GC cell lines was significantly up-regulated (figure 3C). Moreover, through the Gene Expression Profiling Interactive Analysis database (http://gepia.cancer-pku.cn), we found that KIFC1 expression was significantly increased in GC samples compared with paracancerous tissues (figure 3D). Additionally, the Kaplan-Meier Plotter database (http://kmplot.com/analysis/index.php?p=service&cancer) indicated that patients with GC with high expression of KIFC1 had earlier first progression (FP) and shorter overall survival (OS) time (figure 3E). In summary, KIFC1 played a role in promoting cancer in GC.
KIFC1 promoted proliferation, migration and invasion of GC cells
To investigate the role of KIFC1 in GC progression, the KIFC1 overexpressing plasmid was transfected into BGC-823 cells, and the KIFC1 shRNA was transfected into MGC-803 cells. Western blot showed that the cells were successfully transfected (figure 4A). CCK-8 and BrdU experiments implied that KIFC1 overexpression significantly promoted the proliferation of GC cells compared with the NC group, whereas KIFC1 knockdown remarkably inhibited the proliferation of GC cells (figure 4B,C). Additionally, Transwell experiments showed that KIFC1 overexpression significantly promoted migration and invasion of GC cells, while KIFC1 knockdown notably inhibited migration and invasion of GC cells (figure 4D). Hence, KIFC1 enhanced the proliferation, migration and invasion of GC cells.
miR-635 negatively regulated KIFC1 by targeting it
The binding relationship between miR-635 and KIFC1 was predicted by TargetScan (http://www.targetscan.org/vert_72/), and it suggested there was a binding site between miR-635 and KIFC1 (figure 5A). The KIFC1 3′-UTR WT and mutant reporter vectors containing the miR-635 binding site were constructed, and the miR-635 mimics, KIFC1 WT and mutant reporter vectors were transfected into 293 T cells. As shown, miR-635 markedly suppressed the luciferase relative activity of the WT vector, while miR-635 did not notably affect the luciferase activity of the mutated vector (figure 5B). Subsequently, the correlation between KIFC1 mRNA and miR-635 expression in GC tissues of the 47 patients with GC was analyzed, and the results showed there was a significant negative correlation between them (figure 5C). Furthermore, western blot was conducted to detect the effect of miR-635 on KIFC1 expression. The results revealed that miR-635 suppressed KIFC1 expression, while miR-635 inhibitors promoted KIFC1 expression (figure 5D). Collectively, miR-635 directly targeted KIFC1 and negatively regulated its expression.
miR-635 impeded proliferation, migration and invasion of GC cells by regulating expression of KIFC1
Based on the transfection of KIFC1 overexpressing plasmid or KIFC1 shRNA, miR-635 mimics were cotransfected into BGC-823, and miR-635 inhibitors were cotransfected into MGC-803 cells, respectively (figure 6A). CCK-8 experiments and BrdU experiments implied that, compared with the control group, KIFC1 overexpression promoted the proliferation of BGC-823 cells, while cotransfection of the miR-635 mimics group attenuated this promotion; the cotransfection of miR-635 inhibitors partially reversed the inhibition of proliferation of MGC-803 cells induced by KIFC1 knockdown (figure 6B,C). Additionally, Transwell experiments showed that miR-635 mimics attenuated the enhanced migration and invasion of BGC-823 cells caused by KIFC1 overexpression, while miR-635 inhibitors partially reversed the inhibited migration and invasion of invasion of MGC-803 cells induced by KIFC1 knockdown (figure 6D). In summary, we concluded that miR-635 inhibited the proliferation, migration and invasion of GC cells by repressing KIFC1.
Discussion
GC is one of the most common cancers in the world, with high morbidity and mortality.10 The early symptoms of patients with GC are insidious. Therefore, the first diagnosis of most patients with GC is advanced and the prognosis is poor.11 Dysregulation of oncogenes or tumor suppressors has been found to play an essential role in the development of GC.12 Accumulating miRNAs have been reported to be involved in the growth and metastasis of various tumors. For instance, miR-3663-3p promotes cell proliferation and invasion of papillary thyroid carcinoma by targeting RGS4 and inhibits its apoptosis.13 miR-7-5p inhibits the growth and glucose metabolism of nasopharyngeal carcinoma by binding to E2F3.14 Studies have found that miR-195 is down-regulated in GC, and it represses cell viability, proliferation, migration and invasion through regulating GPRC5A.15 miR-665 can target AKT3 to suppress the proliferation of GC cells and promote its apoptosis.16 In addition, miR-635 is down-regulated in non-small-cell lung carcinoma and it significantly inhibits the growth and invasion of xenograft tumors, and functions as a tumor suppressor.17 However, the expression and role of miR-635 in GC remain largely unknown. Therefore, in the study of GC, miR-635 expression in normal gastric tissues and GC tissues was detected by qRT-PCR, and miR-635 was demonstrated to be lowly expressed in GC, and miR-635 expression dysregulation was significantly associated with clinicopathological parameters, including increased TNM staging and lymph node metastasis. Furthermore, in vitro experiments have demonstrated that miR-635 can significantly impede the proliferation, migration and invasion of GC cells. In summary, miR-635 acts as a tumor suppressor in GC.
KIFC1 is a C-type kinesin of the kinesin-14 family, which moves towards the minus end of microtubules and is involved during mitotic spindle formation and ciliogenesis.9 KIFC1 is highly expressed in liver cancer, and KIFC1 can promote hepatocellular carcinoma (HCC) cell viability and inhibit its apoptosis, indicating that KIFC1 is a potential prognostic biomarker and therapeutic target for HCC.9 Additionally, it is found that KIFC1 is activated by TCF-4, which acts as an oncogene and promotes the development of HCC by regulating HMGA1 transcriptional activity.18 In bladder cancer, KIFC1 accelerates cancer cell proliferation and induces EMT through Akt/GSK3β signaling transduction.8 However, the role of KIFC1 in GC is far from being illustrated. In this study, qRT-PCR and IHC data implied that KIFC1 was highly expressed in GC tissues and cells, and bioinformatics analysis suggested that KIFC1 expression in GC samples was remarkably higher than that in normal tissues. Importantly, KIFC1 expression was negatively correlated with the survival time of FP and OS. Furthermore, in vitro experiments confirmed that KIFC1 significantly enhances the proliferation, migration and invasion of GC cells. Several studies have reported the role of KIFC1 in GC. It is reported that GC cases positive for KIFC1 were found more frequently in stage III/IV cases than in stage I/II cases; additionally, KIFC1-positive GC cases showed high Ki-67 labeling index, suggesting that KIFC1 is associated with high-proliferation potential of cancer cells.19 Another study demonstrates that overexpression of KIFC1 is linked to the enhanced spheroid formation ability of GC cells, suggesting that KIFC1 is probably a modulator of GC carcinogenesis.20 Our demonstrations were consistent with these previous reports.
Interestingly, some studies report that the dysregulation of KIFC1 in cancer tissues is due to the abnormal expression of its upstream miRNAs. For instance, in hepatocellular carcinoma, inhibition of miR-532-3p contributes to the overexpression of KIFC121; in renal cell carcinoma, KIFC1 is identified as a target gene of miR-338-3p.22 In GC, miR-135a acts as a regulator of KIFC1.23 In this study, KIFC1 was predicted as a potential target for miR-635 through Targetscan database. Furthermore, dual-luciferase reporter gene assay and western blot implied that miR-635 could negatively regulate KIFC1 expression. Furthermore, in vitro experiments have demonstrated that miR-635 can inhibit the proliferation, migration and invasion of GC cells through KIFC1. In summary, we concluded that miR-635 could target and regulate KIFC1 to modulate the malignant phenotypes of GC cells. These demonstrations not only partly explained the downstream mechanism by which miR-635 was involved in the progression of GC, but also helped improve the understanding of the mechanism of KIFC1 dysregulation in GC.
In conclusion, we found for the first time in GC that miR-635 inhibited the proliferation and metastasis of GC cells by targeting KIFC1. miR-635 and KIFC1 are potential indicators for assessing the clinical progress of GC and evaluating the prognosis of patients, and this work provides new potential therapeutic targets for patients with GC.
Footnotes
Contributors F-YC and Y-BZ conceived and designed the experiments, F-YC, CY, S-YH and X-BH performed the experiments, S-YH carried out the statistical analysis, F-YC and S-LT wrote the paper. All authors read and approved the final manuscript.
Funding The authors have not declared a specific grant for this research from any funding agency in the public, commercial or not-for-profit sectors.
Competing interests None declared.
Patient consent for publication Not required.
Ethics approval Our study was approved by the ethics review board of Renmin Hospital of Wuhan University (approval number: 2017F014).
Provenance and peer review Not commissioned; externally peer reviewed.
Data availability statement Data are available upon reasonable request. The data used to support the findings of this study are available from the corresponding author upon request.